Old 13th December 2002, 14:28   #41
raydream
Banned
 
Join Date: Jun 2002
Posts: 867
ya'know daz, most big sites can now sue for mock-sites such as that page, it would be wise not to flash the url about if you make one.
raydream is offline   Reply With Quote
Old 13th December 2002, 14:37   #42
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Let's see condoms {for oral sex?} vaginal dam, clorox, boiling water
ohhhhhhhhhhhhh.......Forget It!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 14:40   #43
Dazfish
Senior Member
 
Dazfish's Avatar
 
Join Date: Oct 2002
Location: K-PAX
Posts: 187
Send a message via ICQ to Dazfish Send a message via AIM to Dazfish
didnt realise the word moo was copyrighted

bah ok i deleted it, but the mock was nice
Dazfish is offline   Reply With Quote
Old 13th December 2002, 15:14   #44
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
Quote:
Originally posted by raydream

ROWR... hehe baby, you know inteligence is a turnon for me :P, just you wait
ATA CTAOGTGGAA TACOU CGAGCCTATGATAGAGAGGCTATG


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 15:15   #45
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Quote:
Originally posted by Aquila Blue


ATA CTAOGTGGAA TACOU CGAGCCTATGATAGAGAGGCTATG
Yeah, right! Easy for you to say!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 15:39   #46
raydream
Banned
 
Join Date: Jun 2002
Posts: 867
Quote:
Originally posted by Aquila Blue


ATA CTAOGTGGAA TACOU CGAGCCTATGATAGAGAGGCTATG
just you wait
raydream is offline   Reply With Quote
Old 13th December 2002, 15:42   #47
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
O.O {psssssssst. boil everything }
Widdykats is offline   Reply With Quote
Old 13th December 2002, 15:54   #48
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Quote:
Originally posted by Aquila Blue
ATA CTAOGTGGAA TACOU CGAGCCTATGATAGAGAGGCTATG
Mmm, tacos!

But seriously, what is that? I was thinking it was some DNA strand, but aren't there only 4 types? You've got 6 there - A C G O T U (are the O and U typos?)

Don't mind me, I know just enough to be dangerous.

And Widdy, I'm inventing a full body latex dipping machine, so your worries will soon be over.
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 16:03   #49
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Thank You
Widdykats is offline   Reply With Quote
Old 13th December 2002, 16:10   #50
randman
Guest
 
Posts: n/a
Quote:
Originally posted by J. Burnaway

Don't mind me, I know just enough to be dangerous.

And Widdy, I'm inventing a full body latex dipping machine, so your worries will soon be over.
Never have two sentences complimented each other SO perfectly.
  Reply With Quote
Old 13th December 2002, 16:14   #51
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Another country heard from .....hehehehehehehe
Widdykats is offline   Reply With Quote
Old 13th December 2002, 17:52   #52
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Quote:
Originally posted by randman
Never have two sentences complimented each other SO perfectly.
Finally, someone notices and appreciates my own special kind of lack of genius!
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 18:32   #53
raydream
Banned
 
Join Date: Jun 2002
Posts: 867
Quote:
Originally posted by Aquila Blue


ATA CTAOGTGGAA TACOU CGAGCCTATGATAGAGAGGCTATG
I love you too angel
raydream is offline   Reply With Quote
Old 13th December 2002, 18:35   #54
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Naaah, nahhhhhhh,,nah, that's not what that says. It says:
Don't forget the Blood Test, Honey! Yep!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 18:44   #55
hammerhead
The Shark
(Forum King)
 
hammerhead's Avatar
 
Join Date: Jul 2002
Posts: 2,537
Send a message via AIM to hammerhead
Quote:
Originally posted by Aquila Blue


hey, that's not very nice

I'm a scientist that is conducting cancer research and it's not all our fault you know

Actually, it's been known for a long time that HPV (human papiloma virus) is a main cause of cervical cancer in women and it makes sense that if the virus got transmitted to your mouth and infected the cells there, it would cause cancer. Now it's been awhile since I studies HPV since I'm not working on cervicle cancer, but I think it's HPV16 and 18 which are the main causes. They produce proteins that interfer with certain tumour-suppersor genes, p53 being one of the proteins they interfer with. Now p53 is very important because it mediates check-point control in the cell cycle and it is involved in controling apoptosis (regulated cell death).

A note of warning as well, smoking has a negative effect if you have HPV. Women who smoke and have HPV have a higher chance of getting cervical dysplasia.

To add to White_Raven's list of things that can cause cancer, normal cellular metabolism can cause endogenous DNA damage as well. So just by your cells working normally, they can cause mutations. (If you want to know more about this, just ask, this is an area that I actually know a little about)
sorry
hammerhead is offline   Reply With Quote
Old 13th December 2002, 18:59   #56
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
if you want weird transmission routes for STDs, you can't beat the paper that won the 1996 Ig Noble Awards for Public Health. Unfortunately the website does not actually have the paper or the blurb on what the paper was about, but I'll do my best to reitterate.

PUBLIC HEALTH
Ellen Kleist of Nuuk, Greenland and Harald Moi of Oslo, Norway,
for their cautionary medical report "Transmission of Gonorrhea
Through an Inflatable Doll." [Published in "Genitourinary
Medicine," vol. 69, no. 4, Aug. 1993, p. 322.]

Basically what had happened was the captain of a ship when the ship returned to port after 3 weeks at sea, went to see doctors about a case of the clap. It turns out that he did indeed have gonorrhea, which he did not have before he left on the voyage. The ship's compliment was entirely male and the captain insisted that he had not had any homosexual incounters. After further interviews with the man, the doctors managed to find out what had probably happened. it turns out that during the voyage, the captain had unbeknownst to the owner, "borrowed" a certain item from one of his crew, an inflatable doll, of which the owner had recently partook of. The crewman who owned the doll was trackdown and he did indeed have gonorrhea which he had contracted from a non-inflatable female before shipping out. The captain had gotten the gonorrhea from the doll.

Talk about unlikely transmission routes!


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 19:01   #57
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Uh, look up Aquilla. hehehehhehehehe
Widdykats is offline   Reply With Quote
Old 13th December 2002, 19:02   #58
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Now that's why I love science! I can't wait until that is on CSI!
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 19:07   #59
raydream
Banned
 
Join Date: Jun 2002
Posts: 867
Quote:
Originally posted by Widdykats
Naaah, nahhhhhhh,,nah, that's not what that says. It says:
Don't forget the Blood Test, Honey! Yep!
it's "i love you raydream" written in codons, ATA codes for the base isoleucine, whose one letter code = I, and so on, the O and U have no relative amino acids, so she wrote them in as normal
raydream is offline   Reply With Quote
Old 13th December 2002, 19:07   #60
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
Quote:
Originally posted by Widdykats
Uh, look up Aquilla. hehehehhehehehe
wha? oh I see... yeah, that flourescent light really needs to be replaced thanks for pointing it out to me Widdy, I'll get someone to replace it on Monday.







lol, really, what was I suppose to see?

oh yeah, science rules!

To hammerhead, don't feel bad, I didn't mean to single you out, everyone was dumping on the scientist, you were just the most quotable


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 19:08   #61
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Group Photo After Aquila's Festive Report!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 19:13   #62
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
CSI is a pretty good show. I have to admit, I'm a sucker for the forensic science shows (not sure why... lol) The science is CSI is actually pretty good, except that all test results are available in an hour! That is definately not true, lol, sometimes these tests take days, but overall, pretty good.


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 19:19   #63
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Aquila. take a closer look........see the expression on the faces
............hummmmm la la la ok got it NOW! hehehehehehe

ps I'm Screwed!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 19:25   #64
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
they all look so grim... it's like somebody died


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 19:25   #65
Xerxes
Capitalist Alumni
 
Xerxes's Avatar
 
Join Date: May 2000
Location: my 4 Houses on Park Place
Posts: 8,687
Send a message via ICQ to Xerxes


Science Rules
Xerxes is offline   Reply With Quote
Old 13th December 2002, 19:32   #66
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Quote:
Originally posted by Aquila Blue
they all look so grim... it's like somebody died
Well, half of 'em are thinking..."Oh, God! I gotta get tested "
And the other half are thinking,"I'm Screwed"
Widdykats is offline   Reply With Quote
Old 13th December 2002, 19:35   #67
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Actually, the guy on the left is thinking, "I hope no one notices my combover."
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 19:48   #68
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Quote:
Originally posted by J. Burnaway
Actually, the guy on the left is thinking, "I hope no one notices my combover."
AAHAHAHAHahahahahahahahaahaha.......you really crack me up!
Widdykats is offline   Reply With Quote
Old 13th December 2002, 19:56   #69
AjStone
Major Dude
 
AjStone's Avatar
 
Join Date: Mar 2001
Location: Texas, USA
Posts: 993
Send a message via ICQ to AjStone Send a message via AIM to AjStone Send a message via Yahoo to AjStone
Quote:
Originally posted by JustSomeOni
I give oral sex daily!

I DONT WANT CANCER!!
Looks like you give anal sex instead...

/me points @ sig

You do realize how much fun I could have by messing with that, don't you?
AjStone is offline   Reply With Quote
Old 13th December 2002, 19:57   #70
Bilbo Baggins
Wind Chime of the Apocalypse
 
Bilbo Baggins's Avatar
 
Join Date: May 2000
Location: The Forest
Posts: 17,229
I have nothing to say, but i fancy another post
Bilbo Baggins is offline   Reply With Quote
Old 13th December 2002, 20:01   #71
Aquila Blue
Major Dude
 
Aquila Blue's Avatar
 
Join Date: Jul 2002
Location: The Digital World
Posts: 908
Quote:
Originally posted by Bilbo Baggins
I have nothing to say, but i fancy another post
come on, no bilbo witty comment on the inflatable doll at least?


Aquila Blue is offline   Reply With Quote
Old 13th December 2002, 20:09   #72
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Won't you be my girl
Won't you be my girl
Won't you be my, be my,
Be my girl

I was blue and lonely,
I couldn't sleep a wink
And I could only get unconscious
If I'd had to much to drink

There was somehow, something wrong somewhere,
And each day seemed grey and dead
The seeds of desperation
Were growing in my head

I needed inspiration,
A brand new start in life,
Somewhere to place affection,
But I didn't want a wife

And then by lucky chance I saw
In a special magazine
An ad that was unusual,
The like I'd never seen,

'Experience something different
With our new imported toy,
She's loving, warm, inflatible
And a guarantee of joy'

She came all wrapped in cardboard,
All pink and shrivelled down
A breath of air was all she needed
To make her lose that frown

I took her to the bedroom
And pumped her with some life,
And later in a moment
That girl became my wife

And so I sit her in the corner
And sometimes stroke her hair
And when I'm feeling naughty
I blow her up with air

She's cuddly and she's bouncy,
She's like a rubber ball,
I bounce her in the kitchen
And I bounce her in the hall

And now my life is different
Since Sally came my way
I wake up in the morning
And have her on a tray

She's everything they say she was
And I wear a permanent grin,
And I only have to worry
In case my girl wears thin

Won't you be my girl
Won't you be my girl
Won't you be my, be my,
Be my girl
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 20:55   #73
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
For Mew, JB, story about a man and his bot.......
Widdykats is offline   Reply With Quote
Old 13th December 2002, 21:03   #74
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
Unfortunately, I think I've seen that movie

(I used to have HBO...)
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 21:06   #75
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
uh, hummmm! Yep just as I thought.......The Robot Thang
poor, poor Mrs. Burnaway. *sigh* does she know?
Widdykats is offline   Reply With Quote
Old 13th December 2002, 21:08   #76
J. Burnaway
Forum King
 
J. Burnaway's Avatar
 
Join Date: Apr 2002
Location: California, USA
Posts: 2,536
Send a message via Yahoo to J. Burnaway
No, she doesn't. I saw it in my pre-Mrs. Burnaway days though - I've stayed away from bots since then.
J. Burnaway is offline   Reply With Quote
Old 13th December 2002, 21:13   #77
Widdykats
The Forum Slut
 
Widdykats's Avatar
 
Join Date: Jun 2002
Location: A place that invites a post pumping whore from NY
Posts: 15,789
Quote:
Originally posted by J. Burnaway
No, she doesn't. I saw it in my pre-Mrs. Burnaway days though - I've stayed away from bots since then.
That is what they all say.
Widdykats is offline   Reply With Quote
Old 14th December 2002, 00:00   #78
Bilbo Baggins
Wind Chime of the Apocalypse
 
Bilbo Baggins's Avatar
 
Join Date: May 2000
Location: The Forest
Posts: 17,229
Quote:
Originally posted by Aquila Blue


come on, no bilbo witty comment on the inflatable doll at least?

There is only so much you can fill an inflatable doll...
Bilbo Baggins is offline   Reply With Quote
Old 14th December 2002, 02:03   #79
Oni-Dracula
Registered User
 
Oni-Dracula's Avatar
 
Join Date: Aug 2002
Posts: 1,590
Quote:
Originally posted by Widdykats
O.O {psssssssst. boil everything }
mmm boiled human skin
Oni-Dracula is offline   Reply With Quote
Old 14th December 2002, 02:22   #80
raydream
Banned
 
Join Date: Jun 2002
Posts: 867

"Sex is like a box of chocolates.
You never know what you're gonna get." - neko 2002
raydream is offline   Reply With Quote
Reply
Go Back   Winamp & Shoutcast Forums > Community Center > General Discussions

Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

Forum Jump